{"id":136,"date":"2021-09-25T22:07:53","date_gmt":"2021-09-25T22:07:53","guid":{"rendered":"http:\/\/cetaitdemain.org\/?p=136"},"modified":"2021-09-25T22:07:53","modified_gmt":"2021-09-25T22:07:53","slug":"%ef%bb%bf9-schematic-diagram-of-the-potential-effects-of-m-csf-and-gm-csf-upon-macrophages-in-the-obstructed-kidney","status":"publish","type":"post","link":"https:\/\/cetaitdemain.org\/?p=136","title":{"rendered":"\ufeff9 Schematic diagram of the potential effects of M-CSF and GM-CSF upon macrophages in the obstructed kidney"},"content":{"rendered":"<p>\ufeff9 Schematic diagram of the potential effects of M-CSF and GM-CSF upon macrophages in the obstructed kidney. a DCClike phenotype. To determine whether macrophage phenotype might be modulated we tracked CD45. 1+ bone marrow-derived macrophages intravenously administered to CD45.2+ mice with unilateral ureteric obstruction. Circulation cytometry of enzyme dissociated kidneys harvested 3 days later indicated CD11c and MHC Class II upregulation by adoptively transferred CD45.1+ cells with CD45.1+ cells obvious in draining renal lymph nodes. Our data suggests that GM-CSF modulates mononuclear phagocyte plasticity, which likely promotes resolution of injury and healing in the hurt kidney. and, although they are unlikely to have an exact counterpart involved in DC egress from tissues to lymphoid organs. Important functional readouts included phagocytosis (Lucas et al., 2006), and activation of T cell proliferation in the mixed lymphocyte reaction (MLR). In this study, we decided the kinetics of renal M-CSF and GM-CSF protein expression for the first time during unilateral ureteric obstruction (UUO) and tracked the fate and phenotype of CD45.1+ BMM adoptively transferred to CD45.2+ C57B\/6 mice with UUO. M-CSF and GM-CSF are known to be important regulators of mononuclear phagocyte plasticity. This work LP-211 shows that exposure to even small quantities of GM-CSF in the inflamed kidney promotes the acquisition of features in M more commonly associated with DCs, that likely promote the resolution of inflammation and effective renal repair. 2.?Materials and methods 2.1. Experimental mice 6C10 week aged male mice around the C57BL\/6 background (CD45.1 or CD45.2) were bred and maintained in conventional barrier unit facilities at the University or college of Edinburgh or purchased from Harlan, UK. These models are regularly tested in accordance with the Felasa 2014 recommendations, which involves screening for numerous infectious brokers, including parasites. 2.2. Ethics statement All animal work was compliant with IACUC guidelines, conducted in accordance with the UK Government Animals <a href=\"http:\/\/www.ncbi.nlm.nih.gov\/gene\/12817?ordinalpos=2&#038;itool=EntrezSystem2.PEntrez.Gene.Gene_ResultsPanel.Gene_RVDocSum\">Col13a1<\/a> (Scientific Procedures) Take action 1986 and was approved by the University or college of Edinburgh Ethical Review Committee. 2.3. Cell culture M medium consisted of either (i) RPMI (GIBCO, UK) supplemented with 25% FBS LP-211 (GIBCO), 25% L929 supernatant (a source of M-CSF), 2?mM?l-glutamine, 0.25U\/ml penicillin and 100?g\/ml streptomycin or (ii) 20?ng\/ml recombinant murine (rm) M-CSF (Invitrogen, UK) in complete RPMI (10% FBS, l-glutamine and Penicillin\/Streptomycin). DC medium consisted of either (i) 10% GM-CSF conditioned medium in total RPMI or (ii) 20?ng\/ml rm GM-CSF (Invitrogen, UK) added to complete RPMI. BMM and BMDC were prepared from C57BL\/6 bone marrow as previously explained (Kipari et al., 2006). Cells were plated (7.5??106 cells\/plate), cultured in M medium with adherent M obvious at day 7. BMDC were similarly generated using DC medium with supplementary medium added at days 2 and 4. DCs were present as non-adherent cells at day 7. In some experiments, bone marrow cells were cultured for 7 days in Teflon pots. In medium switching experiments, day 7 adherent M and non-adherent DCs were removed to new 6-well culture plates (1C1.5??106 cells\/ well in 3?ml media) and cultured for a further 5 days in either standard or recombinant M medium, DC medium or a mix of M\/DC media (i.e. M\/M, M\/DC, DC\/DC, DC\/M, M\/Mix and DC\/Mix). Following peritoneal lavage, peritoneal M were purified by adhesion to tissue culture plastic. 2.4. Unilateral ureteric obstruction and enzymatic dissociation of organs UUO was performed in anaesthetized 6C10 week male C57BL\/6 mice as previously explained (Kipari et al., 2006). The obstructed left kidneys, and livers, were diced into small <a href=\"https:\/\/www.adooq.com\/lp-211.html\">LP-211<\/a> pieces and incubated in 1.6?mg\/ml Collagenase B (Roche, West Sussex, UK) and 100?g\/ml DNAse 1 (Ambion, Warrington, UK) in RPMI medium at 37?C for 45?min with gentle agitation. Tissue was centrifuged (300?was measured by real-time PCR, using the 7500 Fast Real-Time PCR System (Applied Biosystems) with the expression level normalized to the housekeeping gene -actin. PCR amplifications were performed in a total volume of 20?l containing 1?l cDNA, 4?mM MgCl2, 0.3?mM primers and the SYBR Green I mix. Amplifications were performed in the following conditions: 30?s denaturation at 95?C, 5?s annealing of primers at 55?C and 12?s elongation at 72?C, for 40C50 cycles. Primers for PCR analysis were: TGCTTCAAGAAGGATGTGCGG, GAGGAAAAGGATGTCTGCCACG 2.8. Mixed leukocyte reaction C57BL\/6 BMM and BMDC treated with M medium or DC medium were co-cultured (1??105 cells\/well) in 96-well flat-bottomed plates with splenocytes from BALB\/c mice. After 48?h, 1Ci of [3H]-TdR in 10?l complete medium was added to each well and plates incubated overnight before harvesting and counting using a liquid scintillation counter (Microbeta 1450, Trilux). Quadruplicate measurements per sample were performed and results expressed as counts per minute. 2.9. Fluorescent cell labeling Cells were labeled with the PKH67 Green Fluorescent Cell Linker Kit for General Cell Membrane Labeling.<\/p>\n","protected":false},"excerpt":{"rendered":"<p>\ufeff9 Schematic diagram of the potential effects of M-CSF and GM-CSF upon macrophages in the obstructed kidney. a DCClike phenotype. To determine whether macrophage phenotype might be modulated we tracked CD45. 1+ bone marrow-derived macrophages intravenously administered to CD45.2+ mice with unilateral ureteric obstruction. Circulation cytometry of enzyme dissociated kidneys harvested 3 days later indicated &hellip;<\/p>\n","protected":false},"author":1,"featured_media":0,"comment_status":"closed","ping_status":"open","sticky":false,"template":"","format":"standard","meta":{"footnotes":""},"categories":[31],"tags":[],"class_list":["post-136","post","type-post","status-publish","format-standard","hentry","category-p160rock","entry entry-center"],"_links":{"self":[{"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/posts\/136","targetHints":{"allow":["GET"]}}],"collection":[{"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/posts"}],"about":[{"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/types\/post"}],"author":[{"embeddable":true,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/users\/1"}],"replies":[{"embeddable":true,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcomments&post=136"}],"version-history":[{"count":1,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/posts\/136\/revisions"}],"predecessor-version":[{"id":137,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=\/wp\/v2\/posts\/136\/revisions\/137"}],"wp:attachment":[{"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=%2Fwp%2Fv2%2Fmedia&parent=136"}],"wp:term":[{"taxonomy":"category","embeddable":true,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=%2Fwp%2Fv2%2Fcategories&post=136"},{"taxonomy":"post_tag","embeddable":true,"href":"https:\/\/cetaitdemain.org\/index.php?rest_route=%2Fwp%2Fv2%2Ftags&post=136"}],"curies":[{"name":"wp","href":"https:\/\/api.w.org\/{rel}","templated":true}]}}