[PubMed] [Google Scholar] [12] Uchihara T, Duyckaerts C, He Y, Kobayashi K, Seilhean D, Amouyel P, Hauw JJ. and in mice injected with JNK inhibitor demonstrates that inhibition of JNK may be an effective AF-353 way to increase apoE expression. and [5; 6; 7; 8]. ApoE expression itself is regulated by brain injury and glial activation. ApoE in the CNS is usually expressed primarily AF-353 in glia [10; 11; 12] and upregulated after injury [13]. ApoE is usually downregulated in some types of inflammatory responses; for example, activation of macrophages or glial cells by lipopolysaccharide (LPS) results in decreased apoE levels [8; 14; 15]. ApoE-induced activation of the low density lipoprotein receptor family in microglia counteracts LPS-induced microglial inflammation [8]. Activation of these receptors signals a decrease in c-Jun N-terminal kinase (JNK) activation in microglia, which was vital to overcome LPS-induced decrease in apoE expression [8]. These studies suggested that JNK inhibition alone may be an effective way to increase apoE protein, and this increase in apoE could have anti-inflammatory properties. Thus, our current study aims to further investigate the impact of JNK inhibition on apoE production in the brain. MATERIALS AND METHODS Primary Glial Culture Primary mouse mixed glial cultures were prepared from postnatal day 1 Swiss-Webster mouse pups as previously described [8]. The composition of mixed glial cultures was determined by staining cultures with GFAP (astrocytes), OX42 or Iba1 (microglia), NeuN or MAP-2 (neurons), and APC (oligodendrocytes). Across cultures the composition of cells was about 85 % astrocytes, 15 % microglia, 1 % oligodendrocytes, and 1 % neurons. Intrahippocampal Injections Adult male Swiss-Webster mice (30-40g, Taconic, Hudson, NY) were anesthetized and placed in a stereotaxic apparatus (David Kopf Devices, Tujunga, CA, USA). A single injection, 5 l or 10 l of control, 5 l of 10mM SP600125 (11.01 g), 10 l of 10mM SP600125 (22.02 g), or 5 l of 10mM PD98059 (13.36 g) was delivered to the right hippocampus (from bregma: -1.46 posterior, -1.0 mm lateral, and -2.0 mm ventral) at a constant flow of 0.5 l/min. SP600125 and Csta PD98059 were dissolved in 5 % DMSO AF-353 and 50 % EtOH in PBS and, thus, the control injection was 5 % DMSO, 50 % EtOH in PBS. A total of 12 animals were treated with SP600125 and 10 with vehicle control. Tissue Preparation 24 hrs after injection mice were sacrificed and perfused transcardially with PBS. Proteins from the hippocampi and cortices were extracted in RIPA buffer AF-353 (50mM Tris-HCL, pH 8.0M NaCl, 0.1% Triton X-100) with phosphatase and protease inhibitors. Samples were sonicated for 10 sec, centrifuged at for 10 min at 14,000 rpm, and the supernatant was collected. Western Blot Analyses For all those gels, 15-20 g of protein from cell lysates or conditioned media were analyzed as described [8]. Antibodies ApoE was detected by rabbit polyclonal antibody against rodent apoE (Abcam, Cambridge, MA). ABCA1 was detected by a monoclonal antibody (Biorad). Rabbit polyclonal antibodies against phospho-c-Jun (Ser 73) and phospho-JNK (Thr183/Tyr185) were from Cell Signaling Technology (Beverly, MA). All blots were probed with a monoclonal -actin (Abcam) antibody to ensure equal protein levels in each lane. Chemicals SP600125 was purchased from Invitrogen. L-JNK1 and LPS were purchased from Calbiochem (San Diego, CA). Wortmannin and PD98059 were purchased from Sigma. Quantitative RT-PCR Total RNA was isolated from cultures using Stratagene Completely RNA Miniprep Kit (Stratagene, La Jolla, CA). cDNA was synthesized using Affinity Script QPCR cDNA Synthesis Kit. cDNA (1 l) was amplified by real-time PCR using Power SYBR Green PCR Grasp Mix (Applied Biosystems, Foster City, CA). Samples were standardized to -actin message. Synthetic oligonucleotides ApoE (sense-TCGGAAGGAGCTGACTGG and antisense- CCAGGGTTGGTTGCTTTG) and -actin (sense-TGACAGGATGCAGAAGGAGA and antisense- ACATCTGCTGGAAGGTGGAC) were used. Each individual sample was analyzed in triplicate and RNA levels are reported as fold change compared with control. Analysis of real-time amplification data was done on SDS 2.3 (Applied Biosystems) and relative quantities were calculated using RQ.